substitution.matrices       package:Biostrings       R Documentation

_S_c_o_r_i_n_g _m_a_t_r_i_c_e_s

_D_e_s_c_r_i_p_t_i_o_n:

     Predefined substitution matrices for nucleotide and amino acid
     alignments.

_U_s_a_g_e:

       data(BLOSUM45)
       data(BLOSUM50)
       data(BLOSUM62)
       data(BLOSUM80)
       data(BLOSUM100)
       data(PAM30)
       data(PAM40)
       data(PAM70)
       data(PAM120)
       data(PAM250)
       nucleotideSubstitutionMatrix(match = 1, mismatch = 0, baseOnly = FALSE, type = "DNA")
       qualitySubstitutionMatrices(fuzzyMatch = c(0, 1), alphabetLength = 4L, qualityClass = "PhredQuality", bitScale = 1)
       errorSubstitutionMatrices(errorProbability, fuzzyMatch = c(0, 1), alphabetLength = 4L, bitScale = 1)

_A_r_g_u_m_e_n_t_s:

   match: the scoring for a nucleotide match.

mismatch: the scoring for a nucleotide mismatch.

baseOnly: 'TRUE' or 'FALSE'. If 'TRUE', only uses the letters in the
          "base" alphabet i.e. "A", "C", "G", "T".

    type: either "DNA" or "RNA".

fuzzyMatch: a named or unnamed numeric vector representing the base
          match probability.

errorProbability: a named or unnamed numeric vector representing the
          error probability.

alphabetLength: an integer representing the number of letters in the
          underlying string alphabet. For DNA and RNA, this would be
          4L. For Amino Acids, this could be 20L.

qualityClass: a character string of either '"PhredQuality"' or
          '"SolexaQuality"'.

bitScale: a numeric value to scale the quality-based substitution
          matrices. By default, this is 1, representing bit-scale
          scoring.

_F_o_r_m_a_t:

     The BLOSUM and PAM matrices are square symmetric matrices with
     integer coefficients, whose row and column names are identical and
     unique: each name is a single letter representing a nucleotide or
     an amino acid.

     'nucleotideSubstitutionMatrix' produces a substitution matrix for
     all IUPAC nucleic acid codes based upon match and mismatch
     parameters.

     'errorSubstitutionMatrices' produces a two element list of numeric
     square symmetric matrices, one for matches and one for mismatches.

     'qualitySubstitutionMatrices' produces the substitution matrices
     for Phred or Solexa quality-based reads.

_D_e_t_a_i_l_s:

     The BLOSUM and PAM matrices are not unique. For example, the
     definition of the widely used BLOSUM62 matrix varies depending on
     the source, and even a given source can provide different versions
     of "BLOSUM62" without keeping track of the changes over time. NCBI
     provides many matrices here ftp://ftp.ncbi.nih.gov/blast/matrices/
     but their definitions don't match those of the matrices bundled
     with their stand-alone BLAST software available here
     ftp://ftp.ncbi.nih.gov/blast/

     The BLOSUM45, BLOSUM62, BLOSUM80, PAM30 and PAM70 matrices were
     taken from NCBI stand-alone BLAST software.

     The BLOSUM50, BLOSUM100, PAM40, PAM120 and PAM250 matrices were
     taken from ftp://ftp.ncbi.nih.gov/blast/matrices/

     The quality matrices computed in 'qualitySubstitutionMatrices' are
     based on the paper by Ketil Malde. Let epsilon_i be the
     probability of an error in the base read. For '"Phred"' quality
     measures Q in [0, 99], these error probabilities are given by
     epsilon_i = 10^{-Q/10}. For '"Solexa"' quality measures Q in [-5,
     99], they are given by epsilon_i = 1 - 1/(1 + 10^{-Q/10}).
     Assuming independence within and between base reads, the combined
     error probability of a mismatch when the underlying bases do match
     is epsilon_c = epsilon_1 + epsilon_2 - (n/(n-1)) * epsilon_1 *
     epsilon_2, where n is the number of letters in the underlying
     alphabet. Using epsilon_c, the substitution score is given by when
     two bases match is given by b * log_2(gamma_{x,y} * (1 -
     epsilon_c) * n + (1 - gamma_{x,y}) * epsilon_c * (n/(n-1))), where
     b is the bit-scaling for the scoring and gamma_{x,y} is the
     probability that characters x and y represents the same underlying
     information (e.g. using IUPAC, gamma_{A,A} = 1 and gamma_{A,N} =
     1/4. In the arguments listed above 'fuzzyMatch' represents
     gamma_{x,y} and 'errorProbability' represents epsilon_i.

_A_u_t_h_o_r(_s):

     H. Pages and P. Aboyoun

_R_e_f_e_r_e_n_c_e_s:

     K. Malde, The effect of sequence quality on sequence alignment,
     Bioinformatics, Feb 23, 2008.

_S_e_e _A_l_s_o:

     'pairwiseAlignment', PairwiseAlignedFixedSubject-class,
     DNAString-class, AAString-class, PhredQuality-class,
     SolexaQuality-class

_E_x_a_m_p_l_e_s:

       s1 <- 
         DNAString("ACTTCACCAGCTCCCTGGCGGTAAGTTGATCAAAGGAAACGCAAAGTTTTCAAG")
       s2 <-
         DNAString("GTTTCACTACTTCCTTTCGGGTAAGTAAATATATAAATATATAAAAATATAATTTTCATC")

       ## Fit a global pairwise alignment using edit distance scoring
       pairwiseAlignment(s1, s2,
                         substitutionMatrix = nucleotideSubstitutionMatrix(0, -1, TRUE),
                         gapOpening = 0, gapExtension = -1)

       ## Examine quality-based match and mismatch bit scores for DNA/RNA
       ## strings in pairwiseAlignment.
       ## By default patternQuality and subjectQuality are PhredQuality(22L).
       qualityMatrices <- qualitySubstitutionMatrices()
       qualityMatrices["22", "22", "1"]
       qualityMatrices["22", "22", "0"]

       pairwiseAlignment(s1, s2)

       ## Get the substitution scores when the error probability is 0.1
       subscores <- errorSubstitutionMatrices(errorProbability = 0.1)
       submat <- matrix(subscores[,,"0"], 4, 4)
       diag(submat) <- subscores[,,"1"]
       dimnames(submat) <- list(DNA_ALPHABET[1:4], DNA_ALPHABET[1:4])
       submat
       pairwiseAlignment(s1, s2, substitutionMatrix = submat)

       ## Align two amino acid sequences with the BLOSUM62 matrix
       aa1 <- AAString("HXBLVYMGCHFDCXVBEHIKQZ")
       aa2 <- AAString("QRNYMYCFQCISGNEYKQN")
       pairwiseAlignment(aa1, aa2, substitutionMatrix = "BLOSUM62", gapOpening = -3, gapExtension = -1)

       ## See how the gap penalty influences the alignment
       pairwiseAlignment(aa1, aa2, substitutionMatrix = "BLOSUM62", gapOpening = -6, gapExtension = -2)

       ## See how the substitution matrix influences the alignment
       pairwiseAlignment(aa1, aa2, substitutionMatrix = "BLOSUM50", gapOpening = -3, gapExtension = -1)

       ## Compare our BLOSUM62 with BLOSUM62 from ftp://ftp.ncbi.nih.gov/blast/matrices/
       data(BLOSUM62)
       BLOSUM62["Q", "Z"]
       file <- "ftp://ftp.ncbi.nih.gov/blast/matrices/BLOSUM62"
       b62 <- as.matrix(read.table(file, check.names=FALSE))
       b62["Q", "Z"]

