motifRankingForGroup,MotifEnrichmentResults-method {PWMEnrich} | R Documentation |
Get a ranking of motifs by their enrichment in the whole set of sequences
## S4 method for signature 'MotifEnrichmentResults' motifRankingForGroup( obj, bg = TRUE, id = FALSE, order = FALSE, rank = FALSE, unique = FALSE, ... )
obj |
a MotifEnrichmentResults object |
bg |
if to use background corrected P-values to do the ranking (if available) |
id |
if to show PWM IDs instead of target TF names |
order |
if to output the ordering of PWMs instead of actual P-values or raw values |
rank |
if the output should be rank of a PWM instead of actual P-values or raw values |
unique |
if TRUE, only the best rank is taken for each TF (only when id = FALSE, order = FALSE) |
... |
currently unused |
a vector of P-values or raw enrichments sorted such that the first motif is most enriched
if(requireNamespace("PWMEnrich.Dmelanogaster.background")){ ### # load the pre-compiled lognormal background data(PWMLogn.dm3.MotifDb.Dmel, package = "PWMEnrich.Dmelanogaster.background") # scan two sequences for motif enrichment sequences = list(DNAString("GAAGTATCAAGTGACCAGTAAGTCCCAGATGA"), DNAString("AGGTAGATAGAACAGTAGGCAATGAAGCCGATG")) res = motifEnrichment(sequences, PWMLogn.dm3.MotifDb.Dmel) # most enriched in both sequences (sorted by lognormal background P-value) head(motifRankingForGroup(res)) # Return a non-redundant set of TFs head(motifRankingForGroup(res, unique=TRUE)) # sorted by raw affinity instead of P-value head(motifRankingForGroup(res, bg=FALSE)) # show IDs instead of target TF names head(motifRankingForGroup(res, id=TRUE)) # output the rank instead of P-value head(motifRankingForGroup(res, rank=TRUE)) }